Search anything and hit enter
  • Teams
  • Members
  • Projects
  • Events
  • Calls
  • Jobs
  • publications
  • Software
  • Tools
  • Network
  • Equipment
e.g. searching for members in projects tagged cancer
Search for
Count
IN
OUT
Content 1
  • member
  • team
  • department
  • center
  • program_project
  • nrc
  • whocc
  • project
  • software
  • tool
  • patent
  • Administrative Staff
  • Clinical Research Assistant
  • Graduate Student
  • Lab assistant
  • Non-permanent Researcher
  • Permanent Researcher
  • PhD Student
  • Physician
  • Post-doc
  • Project Manager
  • Research Engineer
  • Retired scientist
  • Technician
  • Undergraduate Student
  • Visiting Scientist
  • Deputy Director of Center
  • Deputy Director of Department
  • Deputy Director of National Reference Center
  • Director of Center
  • Director of Department
  • Director of Institute
  • Director of National Reference Center
  • Group Leader
  • Head of Facility
  • Head of Structure
  • Honorary President of the Departement
  • Labex Coordinator
Content 2
  • member
  • team
  • department
  • center
  • program_project
  • nrc
  • whocc
  • project
  • software
  • tool
  • patent
  • Administrative Staff
  • Clinical Research Assistant
  • Graduate Student
  • Lab assistant
  • Non-permanent Researcher
  • Permanent Researcher
  • PhD Student
  • Physician
  • Post-doc
  • Project Manager
  • Research Engineer
  • Retired scientist
  • Technician
  • Undergraduate Student
  • Visiting Scientist
  • Deputy Director of Center
  • Deputy Director of Department
  • Deputy Director of National Reference Center
  • Director of Center
  • Director of Department
  • Director of Institute
  • Director of National Reference Center
  • Group Leader
  • Head of Facility
  • Head of Structure
  • Honorary President of the Departement
  • Labex Coordinator
Search
Go back
Scroll to top
Share
© Melanie Blokesch, EPFL
Flagellated Vibrio cholerae

About

Our work deals with some aspects of bacteria’s impressive capacities to acquire and exchange genes… which enable bacteria to evolve very fast and efficiently !

We study the mechanisms responsible of the bacterial genome variability, with a special interest for those involved in exogenous gene acquisition – the horizontal gene transfer. Our model system is the integron, a natural genetic engineering system involved in the development and dissemination of antibiotic resistance genes among Gram-negative species. We are characterizing the molecular mechanisms in these elements, as well as their evolution and phenotypic impact on host cell physiology.

We have recently moved to the study of the effects of subinhibitory concentrations of antibiotics, on the SOS response induction and beyond to their role as general stress inducers. We mostly use genetics and postgenomics approaches to tackle these questions.

We are also investigating the factors playing a role in the repair and maintenance of the two chromosomes of Vibrio cholerae. All Vibrio species have genome  constituted of two circular chromosomes with distinct dynamic characteristics, and we aim at understanding both the selective benefit of this organization as well as the specific machinery in charge of their maintenance .

 

Members

Projects

Transversal Project

Fundings

Publications

Pictures & Media

misc_feature 46..302

/gene=”oriT RP4″

/SECDrawAs=”Region”

misc_feature 329..359

/gene=”MCS'”

/SECDrawAs=”Region”

CDS complement (392..1321)

/gene=”araC”

/SECDrawAs=”Gene”

CDS 1609..1914

/gene=”ccdB”

/SECDrawAs=”Gene”

misc_feature 1979..2405

/gene=”oriVR6K”

/SECDrawAs=”Region”

CDS complement (2479..3138)

/gene=”cat”

/SECDrawAs=”Gene”

>pSW7848

CAATTGATATCGCGCGCGTAATACGACTCACTATAGGGCGAATTGGGTACCAGCGCTTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGGCGTCGACGGTATCGATAAGCTTGATATCGAATTCCTGCAGCCCGGGGGATCCACTAGTTCTAGAGCCGTCAATTGTCTGATTCGTTACCAATTATGACAACTTGACGGCTACATCATTCACTTTTTCTTCACAACCGGCACGAAACTCGCTCGGGCTGGCCCCGGTGCATTTTTTAAATACTCGCGAGAAATAGAGTTGA TCGTCAAAACCAACATTGCGACCGACGGTGGCGATAGGCATCCGGGTAGT GCTCAAAAGCAGCTTCGCCTGACTAATGCGTTGGTCCTCGCGCCAGCTTA AGACGCTAATCCCTAACTGCTGGCGGAAAAGATGTGACAGACGCGACGGC GACAAGCAAACATGCTGTGCGACGCTGGCGATATCAAAATTGCTGTCTGC CAGGTGATCGCTGATGTACTGACAAGCCTCGCGTACCCGATTATCCATCG GTGGATGGAGCGACTCGTTAATCGCTTCCATGCGCCGCAGTAACAATTGC TCAAGCAGATTTATCGCCAGCAGCTCCGAATAGCGCCCTTCCCCTTGCCC GGCGTTAATGATTTGCCCAAACAGGTCGCTGAAATGCGGCTGGTGCGCTT CATCCGGGCGAAAGAAACCCGTATTGGCAAATATTGACGGCCAGTTAAGC CATTCATGCCAGTAGGCGCGCGGACGAAAGTAAACCCACTGGTGATACCA TTCGCGAGCCTCCGGATGACGACCGTAGTGATGAATCTCTCCTGGCGGGA ACAGCAAAATATCACCCGGTCGGCAGACAAATTCTCGTCCCTGATTTTTC ACCACCCCCTGACCGCGAATGGTGAGATTGAGAATATAACCTTTCATTCC CAGCGGTCGGTCGATAAAAAAATCGAGATAACCGTTGGCCTCAATCGGCG TTAAACCCGCCACCAGATGGGCGTTAAACGAGTATCCCGGCAGCAGGGGA TCATTTTGCGCTTCAGCCATACTTTTCATACTCCCACCATTCAGAGAAGA AACCAATTGTCCATATTGCATCAGACATTGCCGTCACTGCGTCTTTTACT GGCTCTTCTCGCTAACCCAACCGGTAACCCCGCTTATTAAAAGCATTCTG TAACAAAGCGGGACCAAAGCCATGACAAAAACGCGTAACAAAAGTGTCTA TAATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACACTTT GCTATGCCATAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGACGC TTTTTATCGCAACTCTCTACTGTTTCTCCATACCCGTTTTTTTGGATGGA GTGAAACGATGCAGTTTAAGGTTTACACCTATAAAAGAGAGAGCCGTTAT CGTCTGTTTGTGGATGTACAGAGTGATATTATTGACACGCCCGGGCGACG GATGGTGATCCCCCTGGCCAGTGCACGTCTGCTGTCAGATAAAGTCTCCC GTGAACTTTACCCGGTGGTGCATATCGGGGATGAAAGCTGGCGCATGATG ACCACCGATATGGCCAGTGTGCCGGTCTCCGTTATCGGGGAAGAAGTGGC TGATCTCAGCCACCGCGAAAATGACATCAAAAACGCCATTAACCTGATGT TCTGGGGAATATAAGAGCTCCAGCTTTTGTTCCCTTTAGTGAGGGTTAAT TGCGCGCAATTCCCATGTCAGCCGTTAAGTGTTCCTGTGTCACTCAAAAT TGCTTTGAGAGGCTCTAAGGGCTTCTCAGTGCGTTACATCCCTGGCTTGT TGTCCACAACCGTTAAACCTTAAAAGCTTTAAAAGCCTTATATATTCTTT TTTTTCTTATAAAACTTAAAACCTTAGAGGCTATTTAAGTTGCTGATTTA TATTAATTTTATTGTTCAAACATGAGAGCTTAGTACGTGAAACATGAGAG CTTAGTACGTTAGCCATGAGAGCTTAGTACGTTAGCCATGAGGGTTTAGT TCGTTAAACATGAGAGCTTAGTACGTTAAACATGAGAGCTTAGTACGTGA AACATGAGAGCTTAGTACGTACTATCAACAGGTTGAACTGCTGATCTTCA GATCCTCTACGCCGGACGCATCGTGGCCGGATCAGATCTGATATCGTCGC AGACCAAAACGATCTCAAGAAGATCATCTTATTAATCAGATAAAATATTT CTAGGCACCAATAACTGCCTTAAAAAAATTACGCCCCGCCCTGCCACTCA TCGCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATC ACAAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGC CTTGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCC ATATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGC TGAGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGT TTTCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGG AAATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTC ATGGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCAC CGTCTTTCATTGCCATACGAAATTCCGGATGAGCATTCATCAGGCGGGCA AGAATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGT CTTTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATT GAGCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGAT ATATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTT AGCTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTA TTTCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCAT TTTCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGG ATTTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTATTTATTCGGCG