Tapez votre recherche ici
  • Équipes
  • Membres
  • Projets
  • Événements
  • Appels
  • Emplois
  • publications
  • Logiciel
  • Outils
  • Réseau
  • Équipement

A little guide for advanced search:

  • Tip 1. You can use quotes "" to search for an exact expression.
    Example: "cell division"
  • Tip 2. You can use + symbol to restrict results containing all words.
    Example: +cell +stem
  • Tip 3. You can use + and - symbols to force inclusion or exclusion of specific words.
    Example: +cell -stem
e.g. searching for members in projects tagged cancer
Search for
Count
IN
OUT
Content 1
  • member
  • team
  • department
  • center
  • program_project
  • nrc
  • whocc
  • project
  • software
  • tool
  • patent
  • Personnel Administratif
  • Assistant(e) de Recherche Clinique
  • Etudiant(e) M2
  • Aide technique
  • Chercheur(euse) Contractuel(le)
  • Chercheur(euse) Permanent(e)
  • Etudiant(e) en thèse
  • Médecin
  • Post-doctorant(e)
  • Chef(fe) de Projet
  • Ingénieur(e) de Recherche
  • Chercheur(euse) Retraité(e)
  • Technicien(ne)
  • Etudiant(e)
  • Visiteur(euse) Scientifique
  • Directeur(trice) Adjoint(e) de Centre
  • Directeur(trice) Adjoint(e) de Départment
  • Directeur(trice) Adjoint(e) de Centre National de Référence
  • Directeur(trice) de Centre
  • Directeur(trice) de Départment
  • Directeur(trice) d'Institut
  • Directeur(trice) de Centre National de Référence
  • Chef(fe) de Groupe
  • Responsable de Plateforme
  • Responsable de Structure
  • Président(e) d'honneur de Département
  • Coordinateur(trice) du Labex
Content 2
  • member
  • team
  • department
  • center
  • program_project
  • nrc
  • whocc
  • project
  • software
  • tool
  • patent
  • Personnel Administratif
  • Assistant(e) de Recherche Clinique
  • Etudiant(e) M2
  • Aide technique
  • Chercheur(euse) Contractuel(le)
  • Chercheur(euse) Permanent(e)
  • Etudiant(e) en thèse
  • Médecin
  • Post-doctorant(e)
  • Chef(fe) de Projet
  • Ingénieur(e) de Recherche
  • Chercheur(euse) Retraité(e)
  • Technicien(ne)
  • Etudiant(e)
  • Visiteur(euse) Scientifique
  • Directeur(trice) Adjoint(e) de Centre
  • Directeur(trice) Adjoint(e) de Départment
  • Directeur(trice) Adjoint(e) de Centre National de Référence
  • Directeur(trice) de Centre
  • Directeur(trice) de Départment
  • Directeur(trice) d'Institut
  • Directeur(trice) de Centre National de Référence
  • Chef(fe) de Groupe
  • Responsable de Plateforme
  • Responsable de Structure
  • Président(e) d'honneur de Département
  • Coordinateur(trice) du Labex
Recherche
Revenir
Haut de page
Partagez
© Melanie Blokesch, EPFL
Flagellated Vibrio cholerae

Présentation

Notre travail traite de l’impressionnante capacité des bactéries à acquérir et à échanger des gènes… qui leur permettent d’évoluer de manière très rapide et efficace !
 
Nous étudions les mécanismes responsables de la variabilité du génome bactérien avec un intérêt tout particulier pour ceux qui sont impliqués dans l’acquisition de gènes exogènes (transfert horizontal de gènes). Notre système-modèle est l’intégron, un système naturel de capture et d’expression de gènes impliqué dans le développement et la dissémination de gènes de résistance aux antibiotiques, principalement parmi les bactéries à Gram négatif. Nous caractérisons les mécanismes moléculaires de la recombinaison dans ces éléments génétiques, ainsi que leur évolution et leur impact phénotypique sur la physiologie des cellules bactériennes qui les hébergent.
 
Récemment nous avons entrepris l’étude des effets de concentrations sub-inhibitrices d’antibiotiques sur l’induction de la réponse SOS bactérienne, et sur leur rôle en tant que déclencheurs de stress. Nous utilisons principalement des approches génétiques et post-génomiques pour aborder ces questions.
 
Notre équipe étudie également les facteurs jouant un rôle dans la réparation et la maintenance des deux chromosomes de Vibrio cholerae. Toutes les espèces appartenant au genre Vibrio possèdent un génome constitué de deux chromosomes circulaires ayant des caractéristiques dynamiques distinctes, et nous cherchons à comprendre l’avantage sélectif de cette structuration, ainsi que le mécanisme spécifique chargé de coordonner la réplication des deux chromosomes.

Membres

Projets

Projet Transversal

Financements

Publications

Images & Médias

(EN)

misc_feature 46..302

/gene=”oriT RP4″

/SECDrawAs=”Region”

misc_feature 329..359

/gene=”MCS'”

/SECDrawAs=”Region”

CDS complement (392..1321)

/gene=”araC”

/SECDrawAs=”Gene”

CDS 1609..1914

/gene=”ccdB”

/SECDrawAs=”Gene”

misc_feature 1979..2405

/gene=”oriVR6K”

/SECDrawAs=”Region”

CDS complement (2479..3138)

/gene=”cat”

/SECDrawAs=”Gene”

>pSW7848

CAATTGATATCGCGCGCGTAATACGACTCACTATAGGGCGAATTGGGTACCAGCGCTTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGGCGTCGACGGTATCGATAAGCTTGATATCGAATTCCTGCAGCCCGGGGGATCCACTAGTTCTAGAGCCGTCAATTGTCTGATTCGTTACCAATTATGACAACTTGACGGCTACATCATTCACTTTTTCTTCACAACCGGCACGAAACTCGCTCGGGCTGGCCCCGGTGCATTTTTTAAATACTCGCGAGAAATAGAGTTGA TCGTCAAAACCAACATTGCGACCGACGGTGGCGATAGGCATCCGGGTAGT GCTCAAAAGCAGCTTCGCCTGACTAATGCGTTGGTCCTCGCGCCAGCTTA AGACGCTAATCCCTAACTGCTGGCGGAAAAGATGTGACAGACGCGACGGC GACAAGCAAACATGCTGTGCGACGCTGGCGATATCAAAATTGCTGTCTGC CAGGTGATCGCTGATGTACTGACAAGCCTCGCGTACCCGATTATCCATCG GTGGATGGAGCGACTCGTTAATCGCTTCCATGCGCCGCAGTAACAATTGC TCAAGCAGATTTATCGCCAGCAGCTCCGAATAGCGCCCTTCCCCTTGCCC GGCGTTAATGATTTGCCCAAACAGGTCGCTGAAATGCGGCTGGTGCGCTT CATCCGGGCGAAAGAAACCCGTATTGGCAAATATTGACGGCCAGTTAAGC CATTCATGCCAGTAGGCGCGCGGACGAAAGTAAACCCACTGGTGATACCA TTCGCGAGCCTCCGGATGACGACCGTAGTGATGAATCTCTCCTGGCGGGA ACAGCAAAATATCACCCGGTCGGCAGACAAATTCTCGTCCCTGATTTTTC ACCACCCCCTGACCGCGAATGGTGAGATTGAGAATATAACCTTTCATTCC CAGCGGTCGGTCGATAAAAAAATCGAGATAACCGTTGGCCTCAATCGGCG TTAAACCCGCCACCAGATGGGCGTTAAACGAGTATCCCGGCAGCAGGGGA TCATTTTGCGCTTCAGCCATACTTTTCATACTCCCACCATTCAGAGAAGA AACCAATTGTCCATATTGCATCAGACATTGCCGTCACTGCGTCTTTTACT GGCTCTTCTCGCTAACCCAACCGGTAACCCCGCTTATTAAAAGCATTCTG TAACAAAGCGGGACCAAAGCCATGACAAAAACGCGTAACAAAAGTGTCTA TAATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACACTTT GCTATGCCATAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGACGC TTTTTATCGCAACTCTCTACTGTTTCTCCATACCCGTTTTTTTGGATGGA GTGAAACGATGCAGTTTAAGGTTTACACCTATAAAAGAGAGAGCCGTTAT CGTCTGTTTGTGGATGTACAGAGTGATATTATTGACACGCCCGGGCGACG GATGGTGATCCCCCTGGCCAGTGCACGTCTGCTGTCAGATAAAGTCTCCC GTGAACTTTACCCGGTGGTGCATATCGGGGATGAAAGCTGGCGCATGATG ACCACCGATATGGCCAGTGTGCCGGTCTCCGTTATCGGGGAAGAAGTGGC TGATCTCAGCCACCGCGAAAATGACATCAAAAACGCCATTAACCTGATGT TCTGGGGAATATAAGAGCTCCAGCTTTTGTTCCCTTTAGTGAGGGTTAAT TGCGCGCAATTCCCATGTCAGCCGTTAAGTGTTCCTGTGTCACTCAAAAT TGCTTTGAGAGGCTCTAAGGGCTTCTCAGTGCGTTACATCCCTGGCTTGT TGTCCACAACCGTTAAACCTTAAAAGCTTTAAAAGCCTTATATATTCTTT TTTTTCTTATAAAACTTAAAACCTTAGAGGCTATTTAAGTTGCTGATTTA TATTAATTTTATTGTTCAAACATGAGAGCTTAGTACGTGAAACATGAGAG CTTAGTACGTTAGCCATGAGAGCTTAGTACGTTAGCCATGAGGGTTTAGT TCGTTAAACATGAGAGCTTAGTACGTTAAACATGAGAGCTTAGTACGTGA AACATGAGAGCTTAGTACGTACTATCAACAGGTTGAACTGCTGATCTTCA GATCCTCTACGCCGGACGCATCGTGGCCGGATCAGATCTGATATCGTCGC AGACCAAAACGATCTCAAGAAGATCATCTTATTAATCAGATAAAATATTT CTAGGCACCAATAACTGCCTTAAAAAAATTACGCCCCGCCCTGCCACTCA TCGCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATC ACAAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGC CTTGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCC ATATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGC TGAGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGT TTTCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGG AAATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTC ATGGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCAC CGTCTTTCATTGCCATACGAAATTCCGGATGAGCATTCATCAGGCGGGCA AGAATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGT CTTTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATT GAGCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGAT ATATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTT AGCTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTA TTTCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCAT TTTCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGG ATTTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTATTTATTCGGCG