Tapez votre recherche ici
  • Équipes
  • Membres
  • Projets
  • Événements
  • Appels
  • Emplois
  • publications
  • Logiciel
  • Outils
  • Réseau
  • Équipement
e.g. searching for members in projects tagged cancer
Search for
Count
IN
OUT
Content 1
  • member
  • team
  • department
  • center
  • program_project
  • nrc
  • whocc
  • project
  • software
  • tool
  • patent
  • Personnel Administratif
  • Assistant(e) de Recherche Clinique
  • Etudiant(e) M2
  • Aide technique
  • Chercheur(euse) Contractuel(le)
  • Chercheur(euse) Permanent(e)
  • Etudiant(e) en thèse
  • Médecin
  • Post-doctorant(e)
  • Chef(fe) de Projet
  • Ingénieur(e) de Recherche
  • Chercheur(euse) Retraité(e)
  • Technicien(ne)
  • Etudiant(e)
  • Visiteur(euse) Scientifique
  • Directeur(trice) Adjoint(e) de Centre
  • Directeur(trice) Adjoint(e) de Départment
  • Directeur(trice) Adjoint(e) de Centre National de Référence
  • Directeur(trice) de Centre
  • Directeur(trice) de Départment
  • Directeur(trice) d'Institut
  • Directeur(trice) de Centre National de Référence
  • Chef(fe) de Groupe
  • Responsable de Plateforme
  • Responsable de Structure
  • Président(e) d'honneur de Département
  • Coordinateur(trice) du Labex
Content 2
  • member
  • team
  • department
  • center
  • program_project
  • nrc
  • whocc
  • project
  • software
  • tool
  • patent
  • Personnel Administratif
  • Assistant(e) de Recherche Clinique
  • Etudiant(e) M2
  • Aide technique
  • Chercheur(euse) Contractuel(le)
  • Chercheur(euse) Permanent(e)
  • Etudiant(e) en thèse
  • Médecin
  • Post-doctorant(e)
  • Chef(fe) de Projet
  • Ingénieur(e) de Recherche
  • Chercheur(euse) Retraité(e)
  • Technicien(ne)
  • Etudiant(e)
  • Visiteur(euse) Scientifique
  • Directeur(trice) Adjoint(e) de Centre
  • Directeur(trice) Adjoint(e) de Départment
  • Directeur(trice) Adjoint(e) de Centre National de Référence
  • Directeur(trice) de Centre
  • Directeur(trice) de Départment
  • Directeur(trice) d'Institut
  • Directeur(trice) de Centre National de Référence
  • Chef(fe) de Groupe
  • Responsable de Plateforme
  • Responsable de Structure
  • Président(e) d'honneur de Département
  • Coordinateur(trice) du Labex
Recherche
Revenir
Haut de page
Partagez
© Melanie Blokesch, EPFL
Flagellated Vibrio cholerae

Membres

Projets

Financements

Publications

Images & Médias

(EN)

misc_feature 46..302

/gene=”oriT RP4″

/SECDrawAs=”Region”

misc_feature 329..359

/gene=”MCS'”

/SECDrawAs=”Region”

CDS complement (392..1321)

/gene=”araC”

/SECDrawAs=”Gene”

CDS 1609..1914

/gene=”ccdB”

/SECDrawAs=”Gene”

misc_feature 1979..2405

/gene=”oriVR6K”

/SECDrawAs=”Region”

CDS complement (2479..3138)

/gene=”cat”

/SECDrawAs=”Gene”

>pSW7848

CAATTGATATCGCGCGCGTAATACGACTCACTATAGGGCGAATTGGGTACCAGCGCTTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGGCGTCGACGGTATCGATAAGCTTGATATCGAATTCCTGCAGCCCGGGGGATCCACTAGTTCTAGAGCCGTCAATTGTCTGATTCGTTACCAATTATGACAACTTGACGGCTACATCATTCACTTTTTCTTCACAACCGGCACGAAACTCGCTCGGGCTGGCCCCGGTGCATTTTTTAAATACTCGCGAGAAATAGAGTTGA TCGTCAAAACCAACATTGCGACCGACGGTGGCGATAGGCATCCGGGTAGT GCTCAAAAGCAGCTTCGCCTGACTAATGCGTTGGTCCTCGCGCCAGCTTA AGACGCTAATCCCTAACTGCTGGCGGAAAAGATGTGACAGACGCGACGGC GACAAGCAAACATGCTGTGCGACGCTGGCGATATCAAAATTGCTGTCTGC CAGGTGATCGCTGATGTACTGACAAGCCTCGCGTACCCGATTATCCATCG GTGGATGGAGCGACTCGTTAATCGCTTCCATGCGCCGCAGTAACAATTGC TCAAGCAGATTTATCGCCAGCAGCTCCGAATAGCGCCCTTCCCCTTGCCC GGCGTTAATGATTTGCCCAAACAGGTCGCTGAAATGCGGCTGGTGCGCTT CATCCGGGCGAAAGAAACCCGTATTGGCAAATATTGACGGCCAGTTAAGC CATTCATGCCAGTAGGCGCGCGGACGAAAGTAAACCCACTGGTGATACCA TTCGCGAGCCTCCGGATGACGACCGTAGTGATGAATCTCTCCTGGCGGGA ACAGCAAAATATCACCCGGTCGGCAGACAAATTCTCGTCCCTGATTTTTC ACCACCCCCTGACCGCGAATGGTGAGATTGAGAATATAACCTTTCATTCC CAGCGGTCGGTCGATAAAAAAATCGAGATAACCGTTGGCCTCAATCGGCG TTAAACCCGCCACCAGATGGGCGTTAAACGAGTATCCCGGCAGCAGGGGA TCATTTTGCGCTTCAGCCATACTTTTCATACTCCCACCATTCAGAGAAGA AACCAATTGTCCATATTGCATCAGACATTGCCGTCACTGCGTCTTTTACT GGCTCTTCTCGCTAACCCAACCGGTAACCCCGCTTATTAAAAGCATTCTG TAACAAAGCGGGACCAAAGCCATGACAAAAACGCGTAACAAAAGTGTCTA TAATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACACTTT GCTATGCCATAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGACGC TTTTTATCGCAACTCTCTACTGTTTCTCCATACCCGTTTTTTTGGATGGA GTGAAACGATGCAGTTTAAGGTTTACACCTATAAAAGAGAGAGCCGTTAT CGTCTGTTTGTGGATGTACAGAGTGATATTATTGACACGCCCGGGCGACG GATGGTGATCCCCCTGGCCAGTGCACGTCTGCTGTCAGATAAAGTCTCCC GTGAACTTTACCCGGTGGTGCATATCGGGGATGAAAGCTGGCGCATGATG ACCACCGATATGGCCAGTGTGCCGGTCTCCGTTATCGGGGAAGAAGTGGC TGATCTCAGCCACCGCGAAAATGACATCAAAAACGCCATTAACCTGATGT TCTGGGGAATATAAGAGCTCCAGCTTTTGTTCCCTTTAGTGAGGGTTAAT TGCGCGCAATTCCCATGTCAGCCGTTAAGTGTTCCTGTGTCACTCAAAAT TGCTTTGAGAGGCTCTAAGGGCTTCTCAGTGCGTTACATCCCTGGCTTGT TGTCCACAACCGTTAAACCTTAAAAGCTTTAAAAGCCTTATATATTCTTT TTTTTCTTATAAAACTTAAAACCTTAGAGGCTATTTAAGTTGCTGATTTA TATTAATTTTATTGTTCAAACATGAGAGCTTAGTACGTGAAACATGAGAG CTTAGTACGTTAGCCATGAGAGCTTAGTACGTTAGCCATGAGGGTTTAGT TCGTTAAACATGAGAGCTTAGTACGTTAAACATGAGAGCTTAGTACGTGA AACATGAGAGCTTAGTACGTACTATCAACAGGTTGAACTGCTGATCTTCA GATCCTCTACGCCGGACGCATCGTGGCCGGATCAGATCTGATATCGTCGC AGACCAAAACGATCTCAAGAAGATCATCTTATTAATCAGATAAAATATTT CTAGGCACCAATAACTGCCTTAAAAAAATTACGCCCCGCCCTGCCACTCA TCGCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATC ACAAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGC CTTGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCC ATATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGC TGAGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGT TTTCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGG AAATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTC ATGGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCAC CGTCTTTCATTGCCATACGAAATTCCGGATGAGCATTCATCAGGCGGGCA AGAATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGT CTTTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATT GAGCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGAT ATATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTT AGCTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTA TTTCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCAT TTTCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGG ATTTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTATTTATTCGGCG